bf528.readthedocs.io

bf528.readthedocs.io

Biological Databases Lecture 9 2/16/2018 Instructor: Kritika Karri [email protected] Class Objectives

Why are databases the backbone of bioinformatics ? The basic structure of a database Data storage versus annotation- Refseq Database Types of DBs: Genbank, PubMed, and NCBI Query strategies Quality of data issues 2

Biologists Collect Lots of Data Hundreds of thousand of species Million of articles in scientific literature Genetic Information Gene names (thousands) Phenotype of mutants Location of genes/mutations on chromosomes Linkage (distances between genes) 3 What is a Database ?

A collection data that needs to be : Structured Searchable Updated (periodically) Cross referenced Challenge: To change meaningless data into useful information that can be accessed and analysed the best way possible. For example: How would you organise all biological sequences so that the biological

information is optimally accessible? 4 A spreadsheet can be a Database Columns are Fields Rows are Records Can search for a term within just one field Or combine searched across several fields.

5 Database Organisation Internal Organisation Controls speed and flexibility. A unit of programs that Store Extract Modify Flat file databases (flat DBMS)

Simple, restrictive, table Hierarchical databases Simple, restrictive, tables Relational databases (RDBMS) Complex, versatile, tables Object-oriented databases (ODBMS) Data warehouses and distributed databases 6 Where do the data come from ?

7 Types of Data Sequence or Structure Nucleic acid or protein Important biological information such as about genes and their metabolic pathways, mutations, diseases, drugs, images etc. 8 Biological Database Architecture

9 Types of Database Primary Databases: Original submissions by experimentalists Content controlled by the submitter Examples: GenBank, Trace, SRA, SNP, GEO Secondary databases: Results of analysis of primary databases

Aggregate of many databases Content controlled by third party (NCBI) Examples: NCBI Protein, Refseq, TPA, RefSNP, GEO datasets, UniGene, Homologene, Structure, Conserved Domain 10 11 International Sequence Database Collaboration

International Sequence Database Collaboration: http://www.insdc.org/ National Centre for Biotechnology Information (NCBI) : https://www.ncbi.nlm.nih.gov/ European Nucleotide Archive (ENA) : https://www.ebi.ac.uk/ena DNA Data Bank of Japan (DDBJ) : http://www.ddbj.nig.ac.jp/ 12 Data sharing collaboration Ensure data consistency

Avoid duplication Open data sharing 13 Biological Databases I: Biomedical Literature 14 Biological Database I : Biomedical Literature Database

Medline: https://www.nlm.nih.gov/bsd/pmreso urces.html NLM journal citation database. Includes citations 5,600 scholarly journals published around the world. PubMed https://www.ncbi.nlm.nih.gov/pubme d/

~28 million citations mainly from: MEDLINE indexed journals journals/manuscripts deposited in PMC NCBI Bookshelf 15 Pubmed query builder using MeSH terms MeSH (Medical Subject Headings) is the NLM controlled vocabulary thesaurus used for indexing articles for PubMed.

the U.S. National Library of Medicine's controlled vocabulary (thesaurus). arranged in a hierarchical manner called the MeSH Tree Structures. updated annually 16 PubMed search demo 17 Hands On Exercise I Find all article related to PTEN gene on pubmed.

How many articles did you find ? Modify your search to find entries in Pubmed for PTEN related work from authored by Hui Liang How many articles did you find? Restrict your search and find PTEN related articles by author Hui Liang in Cell Metabolism Journal. What is the full title of the article? Which year it was published in ? Reflection question: What are some advantages of using MeSH term builder? More tutorials on building Pubmed queries for efficient search : https://www.nlm.nih.gov/bsd/disted/pubmedtutorial/cover.html

18 Biological Databases II: Genomics and Transcriptomics 19 Biological Database II- Genomics and Transcriptomics GenBank: https://www.ncbi.nlm.nih.gov/genbank/ Flat file Nucleotide only sequence database Archival in nature: Historical, Redundant

Data: Direct submissions (traditional records), Batch submissions, FTP accounts (genome data) Sample GenBank record (accession number U49845) NCBI: https://www.ncbi.nlm.nih.gov/genbank/samplerecord/#OtherFeaturesB ENA: https://www.ebi.ac.uk/ena/data/view/U49845 DDBJ: http://getentry.ddbj.nig.ac.jp/top-e.html 20 GenBank Flat File 21

Ensembl Contains all the vertebrate genome DNA sequences currently available in the public domain. Automated annotation: by using different software tools, features are identified in the DNA sequences: Genes (known or predicted) Single nucleotide polymorphisms (SNPs) Repeats Homologies Ensembl tools include BLAST, BLAT, BioMart and the Variant Effect Predictor (VEP) for all supported species.

www.ensembl.org 22 Nucleic Acid Structure Database NDB Nucleic acid-containing structures http://ndbserver.rutgers.edu/ NTDB Thermodynamic data for nucleic acids http://ntdb.chem.cuhk.edu.hk/ RNABase RNA-containing structures from PDB and NDB http://www.rnabase.org/ SCOR Structural classification of RNA: RNA motifs by structure, function and tertiary interactions http://scor.lbl.gov/

23 Biological Databases III: Proteomics 24 Biological Database III- Proteomics Protein sequence database: https://www.ncbi.nlm.nih.gov/protein/

25 Genpept 26 Uniprot The Universal Protein Resource (UniProt) is a comprehensive resource for protein sequence and annotation data. UniProt is a collaboration between

the European Bioinformatics Institute (EMBL-EBI), the SIB Swiss Institute of Bioinformatics and the Protein Information Resource (PIR). the entry belongs to the Swiss-Prot section of UniProtKB (reviewed) or to the computer-annotated TrEMBL section (unreviewed). http://www.uniprot.org/

27 Protein Structure database- PDB Protein Data Bank (PDB) http://www.rcsb.org/ Archive-information about the 3D shapes of proteins, nucleic acids, and complex assemblies that helps students and researchers understand all aspects of biomedicine and agriculture, from protein synthesis to health and disease. 28 Protein Family Database

http://pfam.xfam.org/family/piwi Pfam is a database of protein families that includes their annotations and multiple sequence alignments generated using hidden Markov models 29 Protein-Protein Interaction Database STRING: https://string-db.org/ (Search Tool for the

Retrieval of Interacting Genes/Proteins) is a biological database and web resource of known and predicted protein protein interactions. Information from numerous sources, including experimental data, computational prediction methods and public text collections

Nodes: Network nodes represent proteins Edges: Edges represent protein-protein associations 30 Hands-on Exercise II Search Genbank or ensembl for human PTEN gene. What chromosome is this gene located on? Is it a protein coding gene ? How many transcripts this gene have? How many transcripts are functional ?

Does this gene has an alternative splicing events What protein does PTEN gene code for? How many of those protein entries are reviewed? Number of protein-protein interactions for PTEN gene in humans? Are there any records of Post Translational Modification (PTM) ? 31 Data vs Annotation Database RefSeq provide a scientist-curated nonredundant set of biological sequences.

(Derivative) https://www.ncbi.nlm.nih.gov/refseq/ Source: Genbank (INSDC) Annotated: Community collaboration, automated computer, NCBI staff curation Advantages of using RefSeq Non-redundancy Updates to reflect current sequence data and biology Data validation Format consistency Distinct accession series 32

Selected Refseq Accession 33 High-Throughput Sequencing Database Gene Expression Omnibus (GEO) archives and freely distributes high throughput gene expression data submitted by the scientific community. NCBI Sequence Read Archive (SRA) archives raw sequencing data and alignment information from high-throughput sequencing platforms. SRA experiment includes sequence data and metadata regarding how a biological sample was sequenced. Example dataset : https://www.ebi.ac.uk/ena/data/view/SRR494099 database of Genotype and Phenotype(dbGAP): public repository for individual-level

phenotype, exposure, genotype, and sequence data, and the associations between them. https://www.ncbi.nlm.nih.gov/gap European Genome Phenome Archive: repository for a sequence and genotype experiments, case-control, population, and family

studies. https://www.ebi.ac.uk/ega/about 34 Other Specialised Databases UCSC Xena: https://xenabrowser.net/datapages/ Genotype-Tissue Expression Gtex: https://www.gtexportal.org/home/ Correlations between genotype and tissue-specific gene expression levels will help identify regions of the genome that influence whether and how much a gene is expressed.

mirBase:http://www.mirbase.org/ Database of published miRNA sequences and annotation. Each entry represents a predicted hairpin portion of a miRNA transcript (termed mir in the database), with information on the location and sequence of the mature miRNA sequence (termed miR). Pubchem: https://pubchem.ncbi.nlm.nih.gov/ chemical information with structures, information and links DrugBank: https://www.drugbank.ca/ combines detailed drug data with comprehensive drug target information. AND Many MORE !!!!! 35

Database Retrieval Problem with Traditional link method Rapidly growing databases with complex and changing relationships Rapidly changing interfaces to match the above Many people dont know: Where to begin Where to click on a Web page Why it might be useful to click there Entrez GQuery is a retrieval system for searching several linked databases such as: Pubmed, GenBank etc. https://www.ncbi.nlm.nih.gov/gquery/ 36

BLAST BLAST stands for Basic Local Alignment Search Tool Good balance of sensitivity and speed Reliable Flexible Produce local alignments: short significant stretches of similarity, irrespective of where they are in the sequence Blast applies heuristic approach, it does not necessarily find the best hit for your search. 38

BLAST Output List of sequences with scores Raw score Higher is better Depends on aligned length Expect Value (E-value) Smaller is better Independent of length and database size The Expect value (E) is a parameter that describes the number of hits one can "expect" to see by chance when searching a database of a particular size. It decreases exponentially as the Score (S) of the match increases.

Where can I BLAST ? NCBI BLAST web service : https://blast.ncbi.nlm.nih.gov/Blast.cgi EBI BLAST web service : https://www.ebi.ac.uk/Tools/sss/ncbiblast/ FlyBase BLAST : http://flybase.org/blast/ Drosophila and other insects 39 Hands on Exercise III This fragment of genomic DNA belong to a part of gene. >query 1 CTAAACTACCAAGGCCATCTCTACTTAAAAACAGTTGTCTTTTGTTTGTGATTTCAGGGGCCCTGGGTATAAGCGAAGTCCCTGTTTAGAGACCTTGTGAT

GGGTTCAAAATATCAAGAAAGATAGCAAAATATCACAAGCCTCCTGACCCGAGAAGATTAGCGTTGAAAGGGTCTGTCGTGTTTGTTTGGGCCTGGGGC TAAATTCCCAGCCCAAGTGCTGAGGCTGATAATAATCGGGGCGGCGATCAGACAGCCCCGGTGTGGGAAATCGTCCGCCCGGTCTCCCTAAGTCCCCGA AGTCGCCTCCCACTTTTGGTGACTGCTTGTTTATTTACATGCAGTCAATGATAGTAAATGGATGCGCGCCAGTATAGGCCGACCCTGAGGGTGGCGGGGT GCTCTTCGCAGCTTCTCTGTGGAGACCGGTCAGCGGGGCGGCGTGGCCGCTCGCGGCGTCTCCCTGGTGGCATCCGCACAGCCCGCCGCGGTCCGGTCC CGCTCCGGGTCAGAATTGGCGGCTGCGGGGACAGCCTTGCGGCTAGGCAGGGGGCGGGCCGCCGCGTGGGTCCGGCAGTCCCTCCTCCCGCCAAGGCG CCGCCCAGACCCGCTCTCCAGCCGGCCCGGCTCGCCACCCTAGACCGCCCCAGCCACCCCTTCCTCCGCCGGCCCGGCCCCCGCTCCTCCCCCGCCGGC CCGGCCCGGCCCCCTCCTTCTCCCCGCCGGCGCTCGCTGCCTCCCCCTCTTCCCTCTTCCCACACCGCCCTCAGCCGCTCCCTCTCGTACGCCCGTCTGAA GAAGAATCGAGCGCGGAACGCATCGATAGCTCTGCCCTCTGCGGCCGCCCGGCCCCGAACTCATCGGTGTGCTCGGAGCTCGATTTTCCTAGGCGGCGG CCGCGGCGGCGGAGGCAGCAGCGGCGGCGGCAGTGGCGGCGGCGAAGGTGGCGGCGGCTCGGCCAGTACTCCCGGCCCCCGCCATTTCGGACTGGGA GCGAGCGCGGCGCAGGCACTGAAGGCGGCGGCGGGGCCAGAGGCTCAGCGGCTCCCAG Using BLAST search determine which gene/genes is this query fragment

associated with? 40 41

Recently Viewed Presentations

  • Paleolithic and Neolithic - Loudoun County Public Schools

    Paleolithic and Neolithic - Loudoun County Public Schools

    Paleolithic and Neolithic. Unit 1. Bellringer. Practice walking in, picking up papers by the door and placing your homework in the in box before the bell rings. ALL CELL PHONE SHOULD BE. TURNED OFF! ... Station 4: Vocabulary Words m(1-18)/...
  • Exploring the Intersectionality of Science and Racial ...

    Exploring the Intersectionality of Science and Racial ...

    Mentoring: Proven Strategies for Success: Session 5: Evaluation and Tool 04/24/14 Assessment of Mentoring "Assessment is the process through which we gather evidence about the claims we are making with regard to student learning and the process/delivery of mentoring in...
  • Cardiopulmonary Resuscitation - calicutcardiosr.in

    Cardiopulmonary Resuscitation - calicutcardiosr.in

    1) High-Frequency Chest Compressions. High-frequency chest compression (typically at a frequency >120 per minute) has been studied as a technique for improving resuscitation from cardiac arrest and have demonstrated mixed results. The 2010 AHA Guidelines for CPR and ECC recommend...
  •  Duaa Abu-Hamzah al-Thamaliy (Arabic text with English Translation

    Duaa Abu-Hamzah al-Thamaliy (Arabic text with English Translation

    Dua'a Abu-Hamzah. al-Thamaliy. دعاء أبي حمزة . الثمالي (Arabic text with English Translation & English Transliteration) For any errors / comments please write to: [email protected]
  • Industrial Robotics

    Industrial Robotics

    presents KaaShiv InfoTech ROBOTICS For Inplant Training / Internship, please download the "Inplant training registration form" from our website www.kaashivinfotech ...
  • GCSE PE 9 Mark Question Booklet How to

    GCSE PE 9 Mark Question Booklet How to

    GCSE PE. 9 Mark. Question. Booklet . How to answer an exam question . 1.Highlight the command word and write what it means next to it . 2. ... of the grip dynamometer test and the Harvard step test for...
  • Gerencia de CalidadProf Walter Lpez Definicin de Calidad

    Gerencia de CalidadProf Walter Lpez Definicin de Calidad

    Durante los procesos de producción Cuando se recibe un producto de algún suplidor Antes de entrar a procesos costosos e irreversibles Al finalizar el proceso de producción Antes de hacer la entrega del producto Al momento de contactar al consumidor...
  • IABA annual meeting 2018 IFRS 17 Insurance Contracts

    IABA annual meeting 2018 IFRS 17 Insurance Contracts

    Fair value could be derived by adjusting IFRS 17 fulfilment and risk adjustment liabilities to reflect a market participants viewpoint and include other non-attributed expenses that a market participant would expect to be covered by the premium. Not required to...