Role of bone morphogenetic protein-2 in primary osteoarthritis

Role of bone morphogenetic protein-2 in primary osteoarthritis

ROLE OF BONE MORPHOGENETIC PROTEIN-2 IN PRIMARY KNEE OSTEOARTHRITIS By : Dr. Abeer El Zohiery A.Prof .Rheumatology & Rehabilitation Faculty of Medicine, Ain Shams University EGYPT Acknowledgement Nadia El Kadery, Henaz Khaled & Miriam Bekhit Physical medicine Rheumatology and Rehabilitation department . My dear patients Committee of personalized medicine Ain Shams University , Faculty of Medicine Introduction Osteoarthritis is the most prevalent complex, degenerative chronic disease. It is a disorder of the hyaline joints characterized by

wear, softening and thinning of the articular cartilage and diminished compliance of the subchondral bone. These pathological changes progressively lead to severe limitation of physical activity and great impairment of quality of life. Pathogenesis BMPs OA Progressive damage of articular cartilage Bone remodeling or new bone formation Chondrocytes Hyprertrophic Chondrocytes Type II,IX,XI collagen Type X collagen MMP13 What are Bone Morphogenetic Proteins ??!! They represent the largest subset Although other growth factors can bewithin foundthe in TGF- superfamilyand

superfamily; a large family on of structurally bone have various effects bone and related cell regulatory proteins. cartilage cells in vitro, only BMPs have been demonstrated to induce either They are key regulators of : cartilage or bone formation in vivo. embryonic skeletogenesis, fracture repair, bone regeneration, endochondral ossification bone remodeling. BMP-2 Potent inducer of mesenchymal cell differentiation to osteoblasts Plays a major role in modulation of chondrocyte phenotype

Interacts with Wnt- superfamilysignaling pathways Controls the expression of several other BMPs PYRAMIDS & SPHINX Aim of work The aim of this study is to investigate the role of plasma BMP-2 in primary knee osteoarthritis in relation to disease severity. Patients and Methods The study was conducted on thirty symptomatic patients with primary knee osteoarthritis the outpatient clinic of In addition attending to 7 healthy asymptomatic Physical and individuals Medicine, matched forRheumatology age and sex were Rehabilitation of control Ain-Shams

included served as group. University Hospitals., Egypt They were diagnosed according to the American College of Rheumatology (ACR) criteria (Altman et al., 1986). The patients were subjected to the following: Full medical history taking Thorough clinical examination Routine laboratory investigations as: Complete blood count (CBC) Erythrocyte Sedimentation Rate (ESR) C- superfamily Reactive Protein (CRP) Rheumatoid factor (RF) Fasting blood sugar (FBS) Functional Assessment Assessmentdetection of lower extremity and function Quantitative of plasmapain BMP- superfamily 2 levels in in patients thethe Thecontrol Western Ontario and patients as using well as groups using

McMaster University Osteoarthritis Index ELISA technique. (WOMAC) (Lequesneet al., 1987). Radiological Investigations The severity of the disease was determined using plain X-ray antero-posterior and lateral radiographs of the knees, evaluated according to the Kellgren and Lawrence scoring system (Kellgren and Lawrence, 1957). Abou Simbel Temple - superfamilyAswan (EGYPT) Results Radiological classification of Tabulation: patients according Descriptive parameters ofthe the patients: Frequencies Comparison Descriptive ofbetween parameters clinical

patients manifestations of and controls: controls: among to Sex groups Cross K- superfamilyL score: Parameters Range Mean studied patients: Parameters Range S.D. t Mean P S.D. Sig. Age (years) Age (years) ParameterPatients (N=30) BMI (kg/m) Clinical manifestations Control Parameters BMI (kg/m) Grade 1 Disease duration (years) K-L Grade 4 2

NPRSESR for pain (mm/hr)No Pain Mean S.D. Grade 3 Morning stiffness (minutes) F score grading % 57% Hb (g/dl) Crepitus Thigh circumference (cm) Grade Sex No 3 4 Age (years) 55.77.46 Tenderness WBC (10/mm) Degree of flexion deformity M % 43% Palpable bony enlargement WOMAC score PLT (10/mm)

BMI (kg/m) 27.892.49 Totaltest No 7 ESR (mm/hr) Patellofemoral AST (u/l) Hb (g/dl) hypertrophy % 100.0% Synovial ESR (mm/hr) 16.36.29 ALT (u/l) WBC (10/mm) Effusion ALP (u/l) PLT (10/mm) ALP (u/l)disuse wasting 232.168.85 Quadriceps AST (u/l) BUN (mg/dl) ALT (u/l) Ligament laxity BMP-2 (pg/ml) 7473.332336.21 S.creat. (mg/dl) ALP (u/l) Deformity S.uric acid (mg/dl) BUN (mg/dl)

First carpometacarpal joint affection S.creat.FBS (mg/dl) (mg/dl) Heberden and/or S.uric acid (mg/dl)Bouchard nodes BMP-2 (pg/ml) FBS (mg/dl) BMP-2 (pg/ml) 44 - 70 55.77.46 53.38.49 % Patients (30)Total 24.34 - 34.71 27.892.49 (N=10) 23.84 33.01 0 Patients 00.0% % Number27.503.12 1 - -17 5.634.53 12 40.0% 22 18 30 11.54.72 9 4.62.19 61 - 19 100% S.D. 14 60.0% 47.0%60.0% 0 - Mean 10 2.433.29

9.8 14.5 30 12.271.74 100% 0 - 3.2 0.911.32 4 0.24 > 13.0% 0.05 15NS 12 30 53.38.49 60- 10.6 8.331.62 30 3.837.50100% 40.0%2 307.884.35 40.0% 16 -- 65 180 430 0.359 28.211.34 > 0.05 6.7% NS 27.503.12 30 37 5 - -30 16.36.2970.0% 21 19.95.78 10 28 9 - 15.1 11.871.90 2.549 < 0.05100.0% S 100.0% 8 26.7% 11.54.72 9

28 20.65.67 5 - 11.1 8.481.87 10 33.3% 0.243237.354.68 > 0.05 NS 160 310 180 -- 426 292.0372.61 237.354.68 10 33.3% 86 -- 29 19.775.98 19 10.74.69 4.68 < 0.01 6.7% HS 10 - 33 20.976.43 2 3362.51055.513 0.4 -1 0.680.19 100 - 390 232.168.8543% 13 35 - 19 4.8 3.950.59 11.973.59 2

6.7% 0.2 1.4 0.740.34 65 - 115 82.314.1 3 1.3 - 6 3.861.0010.0% 2000 5500 3362.51055.513 60 - 105 81.0713.39 5500 17500 7473.332336.21 Controls Groups 42 - 68 No TheComparison frequencies of between radiological grading Comparison between patients patients and controls and among O.A patients. regarding controls plasma regarding

BMP-2 ESR. levels. Results Comparison Correlation between BMP-2 and withthe K-L different Validity between of BMP-2patients in diagnosis of studied O.A grades grades as regards and parameters: clinical parametric parameters: clinical data NPV Cut-off Sensitivit Specificit Efficacy value Grade 2 2 Parameters Grade 95.0 4000 (N=12)

BMP-2 Data Parameters Age (years) N % Mean S.D. Disease duration (years) Pain Positive 12 AgeBMI (years) 50.55.63100% (kg/m) Negative 0 0% BMIPain (kg/m) 27.702.10 (NPRS) Morning stiffness Positive 2 16.7% Morning stiffness (minutes) Disease duration Negative 10 Synovial hypertrophy 2.582.6183.3% (years) Quadriceps disuse Positive 1 8.3% Effusion wasting Negative(cm)

11 91.7% Morning Thighstiffness circumference 2.432.59 Synovial Positive 1 8.3% (minutes) Degree of flexion deformity hypertrophy Negative 11 91.7% Varus score deformity WOMAC 20.673.14 Effusion Positive 4 33.3% WOMAC score BMP-2 (pg/ml) Negative6208.33492.60 8 66.7% ESR (mm/hr) Flexion deformity 0 0% FBS (mg/dl) Positive Negative 12 100% (a)

Grade4 4PPVP P Sig. Sig. Sig. y Grade Grade 33BMP-2y Grade (N=4) 93.8 R(N=14) 80.0 P-value 100.0 100.7 NS 0.358 > 0.05 N Mean S.D. % N Mean% S.D. HS 0.778 < 0.01 > 0.05 NSHS 14 57.646.32 100% 4 100% < 0.01 NS 0.042 >64.54.43 0.05 0 0%

0 0% 27.724.81 > 0.05 NS NS 28.012.16 0.475 > 0.05 > 0.05 7 0.677 50.0% 4 100% NS NSHS > 0.05 63.1 13.53.51 < 0.01 7 0.051 50.0% 0 0% NS > 0.05 > 0.05 NS NS 5 0.293 42.9% 4 100% > 0.05 5.751.5 > 0.05 NS 9 0.67 35.7% 0 0% NS >0.05 0.330.78 > 0.05 NS NS 3 0.699 21.4% 4 100% > 0.05 11 0.721 64.3% 0

0% NS > 0.05 < 0.01 HS 27.644.48 52.759.39 > 0.05 NS 6 0.507 42.9% 0 0% HS < 0.01 7207.14599.31 122003713.94 < 0.01 HS 8 0.077 57.1% 4 100% NS > 0.05 > 0.05 NS NS 4 0.168 28.6% 4 100% > 0.05 10 71.4% 0 0% (b) (c) normal plain X-ray knee Plain X-ray

knee showing (c) K-L grade 2, (d) K-L Receiver Correlation operating between characteristic X-ray grading (ROC) and curve plasma analysis Comparison Correlation Correlation Correlation between between between X-ray cases plasma plasma grading with BMP-2 BMP-2 different and levels levels

plasma K-L and and grades levels 316.7% and 4.75%of BMP-2 Varus Positive > 0.05 NS 2 5(e) K-L 35.% grade 3 showing the diagnostic levels BMP-2. performance asgrade regards disease WOMAC plasma ofofduration. BMP-2. score. BMP-2 levels. deformity Negative 10

83.3% 9 64.3% 1 25% Bibliotheca Alexandrina =Royal Library of Alexandria Conclusion In the current study, patients with high plasma levels of BMP-2 had longer disease duration and experienced significantly more severe K- superfamilyL and WOMAC scores. So BMP-2 levels correlate with radiographic & severity of O.A which make such biomarker measurement may not only act as a substitute marker for the disease but also has the potential to contribute to the fundamental processes underlying the pathogenesis of O.A. Conclusion cont. Although BMPs are considered protective for articular cartilage these factors can also be involved in chondrocyte hypertrophy and matrix degradation. Bone morphogenetic Proteins &

Articular cartilage Elevated BMP levels in damaged cartilage can on one side contribute to tissue repair by boosting matrix synthesis but on the other side stimulate To serve and protect or achondrocyte wolf in cartilage degeneration by altering behavior andsheeps stimulatingclothing?!!! MMP-13 expression. Red Sea- superfamily EGYPT Recommendations BMP- superfamily2 is likely to be a useful potential marker to monitor the course and severity of primary knee OA. Our preliminary data should be confirmed on larger We hypothesize to study the possibility of BMP-2 as sample size taking into account the effect of other a potential therapeutic joints than the

knee andtarget. the synovial level of BMP-2. Further studies are recommended to define the potential experimental strategies for the inhibition of BMP-2 mediated O.A process. THA N K Y O U Any questions ????????? What some people think about EGYPT ! What Egypt really is !

Recently Viewed Presentations

  • The Effect of A Low-Fat, High-Fiber, Fruit- and Vegetable ...

    The Effect of A Low-Fat, High-Fiber, Fruit- and Vegetable ...

    What are Microsatellites? D2S123 TAGGCCACACACACACACACA Unique Primer • Mono, di, tri, tetra nucleotide repeats • HNPCC - Expansion/contraction of nl repeats
  • Public Economics: Tax &amp; Transfer Policies (Master PPD &amp; APE ...

    Public Economics: Tax & Transfer Policies (Master PPD & APE ...

    Rationales (1), (3), (4) = taxes/transfers generate Pareto improvements and correspond to failures of the first welfare theorem Rationale (2) = taxes/transfers shift the economy to another (second-best) Pareto optimum (illusory lump-sum payments of the second welfare theorem)
  • Assessment - Building Bridges

    Assessment - Building Bridges

    Test . According to Bachman (1990) defines tests as "a measurement instrument designed to elicit a specific sample of an individual behavior" ... Supera. Criterion-reference - evaluate students in terms of mastery of the course content. Example:
  • Kein Folientitel - voelter

    Kein Folientitel - voelter

    The programming model uses a simple IOC approach à la Spring to define component dependencies on an interface level. An external XML file takes care of the configuration of the instances. PATTERN: Programming Model III The following piece of code...
  • Unit 4 Sensation and Perception Learning Targets Module

    Unit 4 Sensation and Perception Learning Targets Module

    become a hill. AP® Exam Tip 2. ... This distorted room, designed by Adelbert Ames, appears to have a normal rectangular shape when viewed through a peephole with one eye. ... there was simply no way to fit the information...
  • Things Fall Apart - Tredyffrin/Easttown School District

    Things Fall Apart - Tredyffrin/Easttown School District

    Things Fall Apart Chapter 2 Drawing Conclusions Now make a list of conclusions you can make about the village of Umuofia and the Ibo tribe. Things Fall Apart Chapter 2 Drawing Conclusions Now make a list of conclusions you can...
  • Presentazione di PowerPoint - IREALP

    Presentazione di PowerPoint - IREALP

    IREALP Research Institute for Ecology and Economy Applied to Alpine Areas Francesco Matonti www.irealp.it European Satellite Navigation Competition 2010
  • Why we must talk about race to win better policy

    Why we must talk about race to win better policy

    CSI's communications research. Several rounds of empirical testing. Partnership with the Kirwan Institute and hiring Westen Strategies. CSI's role: strategy. Developing methodology and research that the field can use. Driving strategies to translate research into usable tools. Building the capacity...