What are Microsatellites? D2S123 TAGGCCACACACACACACACA Unique Primer Mono, di, tri, tetra nucleotide repeats HNPCC - Expansion/contraction of nl repeats Strand Slippage D2S123 TAGGCCACACACACACACACA 14 bp Unique
Primer 13-15 BP 4-40 RPTS TAGGCCACACACACACACACA 12 bp Mis-Match Repair Genes hMSH2
hMLH1 PMS1 PMS2 hMSH3 hMSH6 Click for larger picture Click for larger picture Risk of CRC in Clinical HNPCC Families: Netherlands HNPCC
Age Location CI35 CI50 CI75 44 pr: 53% ds: 41% 10% 24% 42%
Sporadic 69 pr: 32% ds: 68% .07% .5% 5.3% Voskuil, Int J CA 1997;72:205 Risk of CRC in MSH2/MLH1 HNPCC Families: Netherlands %
CRC Lifetime 80 Women 83 Men 92 Endometrial
50 Vasen, Gastro 1996;110:1020 HNPCC ~ 90% of tumors show MI Germline defect in MMR genes 2nd Hit - Somatic Mutation MSI in Sporadic CRC 10 - 15% of sporadic CRC
In HNPCC: Germline + somatic = MSI Sporadic - biallelic somatic mutation via methylation of MLH1 promoter TC = Transcription Complex Click for larger picture Gene Testing for hMLH1 or hMSH2
DGGE SSCP IVSP Direct Sequencing Gene Testing Sensitivity Cost ($) Sequencing
>90% 800 - 3,000 CSGE & Sequencing >90% 1500 Screening (SSCP) 95 - 100%
800 Screening (PTT) 50 - 60% 750 MSI NA
300 Gastro 2001;121:195 Gene Testing for MSH2/MLH1 509 Finnish CRC pts 5/10 Founder mutation 63 MSI 7/10 Amsterdam Criteria All either young, had fam hx, or previous CA
10 (2%) MMR mutations Aaltonen, NEJM 1998;38:1481 Predictive Model for MMR Gene Testing 184 Kindreds: 26% w/ MMR mutations 1) Mean age at diagnosis of affecteds 2) At least 1 member w/ Endometrial CA 3) Amsterdam Criteria Wijnen, NEJM 1998;339:511 Predictive Model for MMR Gene Testing Logistic Model
Prob <20% MSI Nothing + MMR Analysis Prob >20% MMR Analysis Wijnen, NEJM 1998;339:511
Bethesda Criteria and MMR Mutation N=125, high risk, Frankfurt, GE + BC - BC Total N 58 (46%)
67 (54%) 125 MSI 17 (29%) 5 (7.5%) 22 (18%)
0 (0%) 11 (9%) MMR Mutation 11 (65%) B1 - B4 46 (79%) Raedle, Ann Int Med 2001;135:566 Bethesda vs. Amsterdam MMR Mutation
MSI status Criteria to predict MSI Sens Spec Amsterdam 6/6 27
94 Amsterdam II 8/10 46 90 Bethesda
11/17 77 60 Raedle, Ann Int Med 2001;135:566 Cost Effectiveness of MSI Decision tree using MSI (Bethesda guidelines) and MMR mutations 90% CI for cost-effectiveness of screening patients with cancer & relatives:
gained $4,874 - 21,576 / life year Sensitivity analysis - prevalence HNPCC mutation #1 factor Ramsey, Ann Int Med 2001;135:577 Click for larger picture Mutations in HNPCC Kindreds 32 Kindreds (N=38) in Buffalo and Vermont
Amsterdam Criteria Incidence of Mutations MSH2/MLH1: 25% Conclusion: Molecular basis unknown for many subjects Weber, Cancer Res 1997;57:3798 Effectiveness of Screening in HNPCC 252 subjects, 22 Families (119 Control, 133 screen) Colon q3yrs, 1984, 15 yr F/U Not randomized - declined participation Screen
CRC Mutation + Deaths to CRC 8 (6%) 18% 0 Control OR 19 (16%) 41% 8%
.4 .4 P .01 .02 <.001 Jarvinen, Gastro 2000;118 Click for larger picture Risk of Metachronous CRC
50 40 30 Population MMR Mutation 20 10 0 10 y
15 y Colonoscopy in High Risk Individuals 31 HNPCC Families - 232 Individuals 86 (38.6%) underwent colonos-compared to controls Case CA Adenomas TV/V (#) Ad Diam HGD (#)
5 29 11 9.1 9 Control 1 11 1 5.8 3
P .03 .02 Ponz de Leon, CEBP 1998;7:639 Center for Families at Risk for CRC Jan 98 - June 00 Goal: To develop a registry of high risk families To assemble blood/DNA for research Recruitment: Physician referral, Media, UPCI CA Registry High Risk Definition: Young onset, FDR young onset, Multiple cancers
Overall: 83 individuals (76 families) UPCI Registry Alive Agreed 26 11 (5.9%) 188 82
Dead 106 23 Not Interested Enrolled 33 Unavailable Young onset cancers - <45, 45-55 High Risk Patients
70 Probands - Complete data, exclude FAP 67.1% High Risk 23 Young Onset (<55) 9 Multiple CAs 15 Young and Multiple (8 Amsterdam Criteria) Problems With Center Lab Support Integrated Recruitment Coordinated Approach With Other Cancers Gene Testing
www.genetests.org www.nsgc.org
