The Effect of A Low-Fat, High-Fiber, Fruit- and Vegetable ...

The Effect of A Low-Fat, High-Fiber, Fruit- and Vegetable ...

What are Microsatellites? D2S123 TAGGCCACACACACACACACA Unique Primer Mono, di, tri, tetra nucleotide repeats HNPCC - Expansion/contraction of nl repeats Strand Slippage D2S123 TAGGCCACACACACACACACA 14 bp Unique

Primer 13-15 BP 4-40 RPTS TAGGCCACACACACACACACA 12 bp Mis-Match Repair Genes hMSH2

hMLH1 PMS1 PMS2 hMSH3 hMSH6 Click for larger picture Click for larger picture Risk of CRC in Clinical HNPCC Families: Netherlands HNPCC

Age Location CI35 CI50 CI75 44 pr: 53% ds: 41% 10% 24% 42%

Sporadic 69 pr: 32% ds: 68% .07% .5% 5.3% Voskuil, Int J CA 1997;72:205 Risk of CRC in MSH2/MLH1 HNPCC Families: Netherlands %

CRC Lifetime 80 Women 83 Men 92 Endometrial

50 Vasen, Gastro 1996;110:1020 HNPCC ~ 90% of tumors show MI Germline defect in MMR genes 2nd Hit - Somatic Mutation MSI in Sporadic CRC 10 - 15% of sporadic CRC

In HNPCC: Germline + somatic = MSI Sporadic - biallelic somatic mutation via methylation of MLH1 promoter TC = Transcription Complex Click for larger picture Gene Testing for hMLH1 or hMSH2

DGGE SSCP IVSP Direct Sequencing Gene Testing Sensitivity Cost ($) Sequencing

>90% 800 - 3,000 CSGE & Sequencing >90% 1500 Screening (SSCP) 95 - 100%

800 Screening (PTT) 50 - 60% 750 MSI NA

300 Gastro 2001;121:195 Gene Testing for MSH2/MLH1 509 Finnish CRC pts 5/10 Founder mutation 63 MSI 7/10 Amsterdam Criteria All either young, had fam hx, or previous CA

10 (2%) MMR mutations Aaltonen, NEJM 1998;38:1481 Predictive Model for MMR Gene Testing 184 Kindreds: 26% w/ MMR mutations 1) Mean age at diagnosis of affecteds 2) At least 1 member w/ Endometrial CA 3) Amsterdam Criteria Wijnen, NEJM 1998;339:511 Predictive Model for MMR Gene Testing Logistic Model

Prob <20% MSI Nothing + MMR Analysis Prob >20% MMR Analysis Wijnen, NEJM 1998;339:511

Bethesda Criteria and MMR Mutation N=125, high risk, Frankfurt, GE + BC - BC Total N 58 (46%)

67 (54%) 125 MSI 17 (29%) 5 (7.5%) 22 (18%)

0 (0%) 11 (9%) MMR Mutation 11 (65%) B1 - B4 46 (79%) Raedle, Ann Int Med 2001;135:566 Bethesda vs. Amsterdam MMR Mutation

MSI status Criteria to predict MSI Sens Spec Amsterdam 6/6 27

94 Amsterdam II 8/10 46 90 Bethesda

11/17 77 60 Raedle, Ann Int Med 2001;135:566 Cost Effectiveness of MSI Decision tree using MSI (Bethesda guidelines) and MMR mutations 90% CI for cost-effectiveness of screening patients with cancer & relatives:

gained $4,874 - 21,576 / life year Sensitivity analysis - prevalence HNPCC mutation #1 factor Ramsey, Ann Int Med 2001;135:577 Click for larger picture Mutations in HNPCC Kindreds 32 Kindreds (N=38) in Buffalo and Vermont

Amsterdam Criteria Incidence of Mutations MSH2/MLH1: 25% Conclusion: Molecular basis unknown for many subjects Weber, Cancer Res 1997;57:3798 Effectiveness of Screening in HNPCC 252 subjects, 22 Families (119 Control, 133 screen) Colon q3yrs, 1984, 15 yr F/U Not randomized - declined participation Screen

CRC Mutation + Deaths to CRC 8 (6%) 18% 0 Control OR 19 (16%) 41% 8%

.4 .4 P .01 .02 <.001 Jarvinen, Gastro 2000;118 Click for larger picture Risk of Metachronous CRC

50 40 30 Population MMR Mutation 20 10 0 10 y

15 y Colonoscopy in High Risk Individuals 31 HNPCC Families - 232 Individuals 86 (38.6%) underwent colonos-compared to controls Case CA Adenomas TV/V (#) Ad Diam HGD (#)

5 29 11 9.1 9 Control 1 11 1 5.8 3

P .03 .02 Ponz de Leon, CEBP 1998;7:639 Center for Families at Risk for CRC Jan 98 - June 00 Goal: To develop a registry of high risk families To assemble blood/DNA for research Recruitment: Physician referral, Media, UPCI CA Registry High Risk Definition: Young onset, FDR young onset, Multiple cancers

Overall: 83 individuals (76 families) UPCI Registry Alive Agreed 26 11 (5.9%) 188 82

Dead 106 23 Not Interested Enrolled 33 Unavailable Young onset cancers - <45, 45-55 High Risk Patients

70 Probands - Complete data, exclude FAP 67.1% High Risk 23 Young Onset (<55) 9 Multiple CAs 15 Young and Multiple (8 Amsterdam Criteria) Problems With Center Lab Support Integrated Recruitment Coordinated Approach With Other Cancers Gene Testing

www.genetests.org www.nsgc.org

Recently Viewed Presentations

  • Planning: Project Readiness and Costs - edu

    Planning: Project Readiness and Costs - edu

    Planning: Project Readiness and Costs Mike Conlon Director of Data Infrastructure University of Florida Copyright Michael Conlon, 2004. This work is the intellectual ...
  • Economic Systems in Latin America

    Economic Systems in Latin America

    Economic Systems in Latin America Traditional Economic System Based on skills that are passed down from generation to generation Mainly focused on agriculture and herding Example Yanomamo Indians in Venezuela Command Economy in Cuba 90% of people work for the...
  • Idaho Public Records Law

    Idaho Public Records Law

    The person or persons having personal custody and control of the public records in question. Writing. Includes, but is not limited to, handwriting, typewriting, printing, photostating, photographing and every means of recording. State agency. Every state officer, department, division, bureau,...
  • Cartoons, Graphs, and Visuals for Practice

    Cartoons, Graphs, and Visuals for Practice

    Which slogan best reflects the point of view of Cecil Rhodes as shown in this cartoon? (1) "Imperialism is a Glorious Pursuit." (2) "Embrace African Diversity." (3) "Unite All Africans." (4) "Connecting Constantinople to Cairo."
  • Presentation kit

    Presentation kit

    CGC. clk. m_clk. MUX. SINKS. SINKS. SINKS. MUX. MUX. MUX. Clocks to all sink groups are generated clocks. Top-level has up to two levels of hierarchy. Reconvergent paths. Top-level has up to two levels of hierarchy. Experimental Setup Six high-speed...
  • Simulation and Risk Analysis - Furman University

    Simulation and Risk Analysis - Furman University

    Simulation and Risk Analysis. Models that include randomness are called stochastic or probabilistic. These models help us evaluate risks associated with undesirable consequences. Riskis simply the probability of occurrence of an undesirable outcome. Risk analysisseeks to examine the impact of...
  • Who are you - Yale University

    Who are you - Yale University

    Every 14 seconds a child is orphaned by HIV LysenkoChem Traxoline ® LysenkoChem Traxoline® mode of action Current level of HIV resistance in the human population is low Traxoline® strengthens this resistance level HIV-specific immune enhancer LysenkoChem Protocol Each generation...
  • 1 Using Rubrics for Student Assessment Peggy Porter

    1 Using Rubrics for Student Assessment Peggy Porter

    Rubric Overview. Rubrics provide the criteria for classifying products or behaviors into categories that vary along a continuum. They can be used to classify virtually any product or behavior, such as essays, research reports, portfolios, works of art, recitals, oral...